Header

Header

Header

MERFISH • Cleavable Read-Out Probes

MERFISH Read-Out Probes & Cleavable Fluorescent Chemistries

Error-tolerant barcoding with iterative, dye-labeled read-out probes that cleanly reset between rounds. Choose disulfide, photocleavable, or enzyme-labile linkers. Manufactured end-to-end in Lewisville, TX with HPLC/UPLC and optional LC-MS.

Speak to Scientist How MERFISH readouts work

Overview

MERFISH Read-Out Probe Technology

MERFISH (Multiplexed Error‑Robust FISH) pairs encoding probes with short, cleavable dye‑labeled read‑out probes to read barcoded targets over iterative imaging rounds. Our read‑outs are engineered for clean signal reset (disulfide, photo, or enzyme‑labile linkers), fast wash/re‑hybridization, and high SNR in tissue or cells — enabling spatial transcriptomics at scale.

Bio-Synthesis offering — Custom MERFISH Read-Out Probes:
Dyes: Cy5, Cy3B, Alexa Fluor series; single or dual labels; optional cleavable linkers.
QC: Dual-HPLC, LC-MS (as requested), OD; delivery as dried tubes or normalized plates.
Kitting: Per-round pooled mixes matched to your codebook for simplified workflows.
Design & Codebooks
Docking tags, Tm targets, error-robust layouts; cross-homology screens.
Manufacturing
RUO→GMP-like; single- or dual-dye; disulfide/photo/enzyme linkers.
QC & Validation
HPLC/UPLC, optional LC‑MS, dye loading & cleavage verification.
Kitting & Logistics
Per‑round mixes matched to your codebook; plates or tubes.
10–10,000+ barcodes
Supported per panel for highly multiplexed MERFISH or cyclic FISH.
<10% CV dye load
Batch-to-batch dye uniformity for consistent multi-round imaging.
RUO → GMP‑like scale
From small panels to kilo-scale runs, with ISO-aligned QC and documentation.
ISO 9001:2015 / ISO 13485:2016 45+ Years of Expertise U.S.A. Facilities-Texas GLP/GMP-Aligned Disulfide-Cleavable Dyes Dual‑Dye Options Photocleavable Options Branch bDNA Amplifier Spatial Transcriptomics QC: HPLC • LC-MS RUO → GMP-like

MERFISH Readout Probes

Read-out probes are short (≈20-nt) oligos complementary to the encoding probe’s docking tags. Dyes are attached via a cleavable linker at the 5′ (typical) or 3′ terminus. After imaging, the dye is removed (e.g., by 5′ disulfide cleavage) and new read-outs are introduced.

Design
Use orthogonal 20–25-mers with Tm 5–8 °C above imaging temp. Avoid cross-homology across all tags.
Dyes
Alexa 568/594/647, Atto 550/647N, Cy5, Alexa 700/750—match filters/lasers and balance crosstalk.
QC
HPLC/UPLC recommended; LC-MS available. We provide dye loading and cleavage verification on request.
Tip: Add a short spacer (e.g., TEG) between dye and oligo to improve accessibility and wash performance.

Branched DNA (bDNA) Amplifiers — Layered Signal Amplification

Diagram shows a single target nucleic acid bound by capture probes. A pre-amplifier hybridizes to the capture complex. Multiple amplifier branches bind to the pre-amplifier. Each amplifier recruits several labeled probes producing a bright signal.

Target → Pre‑Amplifier → Amplifier → Labeled Probes. No PCR of the target—just clean, modular signal build‑up.

Target RNA/DNA Capture + Label Extenders Pre-Amplifier Amplifiers (branched) Labeled Probes Target strand Capture/Label Extenders (tile across target) Pre-Amplifier (multiple amplifier docking sites) Amplifier A Amplifier B Amplifier C
Design notes:
  • Increase branch factor by adjusting amplifier copy number per pre‑amplifier.
  • Choose labels to match instrument channels (e.g., Cy5, Alexa Fluor series).
  • Balance hybridization time vs. background with stringency and wash conditions.

Products & Ordering

Also available: Branched DNA (bDNA) amplifier probes for MERFISH and other signal-amplified spatial RNA methods.

Product / Modification Description Typical Use Notes Code
5′-Dye (Disulfide-Cleavable) Dye via disulfide at 5′ terminus Cyclic imaging / MERFISH resets Fast, dye-agnostic [Dye-SS-5′]
3′-Dye (Disulfide-Cleavable) Disulfide-tethered dye at 3′ Alternate geometry / dual-dye Balances sterics [Dye-SS-3′]
Photocleavable Dye oNB/DMNB or Coumarin linkers Rapid on-scope reset Manage light dose [Dye-PC-5′/3′],[Dye-cPC-5′/3′]
Enzyme-Cleavable Dye Ester/peptide designs Tissue-compatible workflows Longer cycle time [Dye-EC-5′/3′]
Acid/Base-Labile Dye Cleavage via pH shift Orthogonal release Backbone compatibility [Dye-AL/BL-5′/3′]
Dual-Dye Cleavable Read-Out Two dyes with cleavable strategy High SNR / two-color rounds Verify crosstalk [2×Dye-SS/PC]
bDNA Amplifier Probes (Branched DNA System) Nested/branched oligos that hybridize to encoding or readout scaffolds to multiply fluor binding sites and boost signal. MERFISH & smFISH when targets are low-abundance or background is high. Two- or three-stage design (pre-amp → amp); orthogonal sets validated for MERFISH. [bDNA-Amp-Set]

Cleavable Chemistries

Choose the trigger that best fits your sample and microscope. Disulfide is the field standard; photo and enzyme triggers are great alternates.

Linker Trigger Speed Pros Considerations Best-fit uses Code
Disulfide 10–50 mM TCEP/DTT 2–10 min Gentle, dye-agnostic, widely adopted Avoid free thiols pre-imaging MERFISH/cyclic FISH resets [SS-5′], [SS-3′]
Photocleavable (oNB/DMNB) UV/violet light <1–2 min Fast on-scope Phototoxicity management Time-critical cycles [PC-5′/3′]
Photocleavable (Coumarin) Violet/near-UV <1–2 min Lower UV dose Optimize fluence Delicate tissues [cPC-5′/3′]
Enzyme-cleavable Esterase/protease 5–30 min Biocompatible Enzyme sourcing/time Tissue-friendly [EC-5′/3′]
Acid/Base-Labile pH shift 5–15 min Simple buffers Backbone stability Materials/robust cells [AL-5′/3′], [BL-5′/3′]

Technology Workflow

1
2
3
1
Encode
Hybridize encoding probes containing docking tags and target-binding regions.
2
Read-out
Cleave dye (e.g., TCEP for disulfide) to remove signal and start the next round.
3
Reset
Trigger cleavage (reductive, photo, or enzyme) to remove fluorescence and prep the next cycle.
Deliverables: Custom sequences, dye/linker configs, recommended cleavage conditions, storage guidance, lot-linked QC.

Workflow (Cyclic Hybridize → Image → Strip)

Step Description Notes
1. Barcode & Encoding Probe Design Assign a robust bit barcode (e.g., 16-bit) per gene; synthesize encoding probes carrying readout sites. GC-balanced bit sites, Hamming-style error-robust layouts.
2. Primary Hybridization Hybridize encoding probes to fixed cells/tissue; wash to reduce background. Keep temperature and salt gentle to preserve morphology.
3. Readout Hybridization (Round 1) Hybridize fluorescent readouts that match a subset of bit sites across channels. 5′-cleavable linkers (e.g., disulfide) recommended for fast resets.
4. Imaging Acquire multichannel images; detect/fit puncta for each color. Maintain exposure uniformity; include fiducials if needed.
5. Fluorophore Removal Cleave dyes (e.g., TCEP/DTT for disulfide) or use alternative strip chemistries. Leave encoding probes intact; confirm low residual signal.
6. Subsequent Rounds Repeat hybridize → image → strip until all bits are read. Log per-round QC; track drift and background.
7. Barcode Decoding Call presence/absence across rounds/channels to decode each barcode. Error-robust decoding to mitigate dropouts.
8. Spatial Analysis Assign transcripts to cells; compute cell types, neighborhoods, and pathways. Export single-cell tables, expression maps, and region stats.

FAQ

What is a MERFISH read-out probe?
A short, dye-labeled oligo that binds a readout (docking) sequence present on encoding probes. Presence during a round marks a “1”; absence a “0”. Cleavable dyes reset signal between rounds.
Validated MERFISH Readout Probe Sequences (Methods Enzymology – Table 1)

Source: Moffitt & Zhuang, Methods in Enzymology (HHMI/PMC PDF), Table 1 “The sequence of the readouts probes that have been validated.”

ID Sequence (5′→3′)
RO-01 CGCAACGCTTGGGACGGTTCCAATCGGATC
RO-02 CGCGAAATCCCCGTAACGAGCGTCCCTTGC
RO-03 CGAATGCTCTGGCCTCGAACGAACGATAGC
RO-04 GCATGAGTTGCCTGGCGTTGCGACGACTAA
RO-05 ACAAATCCGACGAATGGACCAGATCATGGG
RO-06 CCGTCGTCTCCGGTCCACCGTTGCGCTTAC
RO-07 CAAGTATGCAGCGCGATTGACCGTCTCGTT
RO-08 GGCCAATGGCCCAGGTCCGTCACGCAATTT
RO-09 GCGGGAAGCACGTGGATTAGGGCATCGACCT
RO-10 TTGATCGAATCGGAGCGTAGCGGAATCTGC
RO-11 AAGTCGTACGCCGATGCGCAGCAATTCACT
RO-12 CGCGCGGATCCGCTTGGTCGGGAACGGATAC
RO-13 CGAAACATCGGCCACGGTCCCGTTGAACTT
RO-14 GCCTCGATTACGACGGATGTAATTCGGCCG
RO-15 ACGAATCCACCGTCCAGCGCGTCAAACAGA
RO-16 GCCCGTATTCCCGCTTGCGAGTAGGGCAAT

These readout probes are typically ordered dye-labeled and HPLC-purified. Encoding probes embed the reverse complements of the readout sequences.

Validated Sequences — PNAS 2016 “High-throughput MERFISH” (10.1073/pnas.1612826113)

SI footnote: All read-out probes are 20-nt DNA oligonucleotides with a 5′ disulfide-linked dye (Cy5 or Alexa750). After each round, dyes are cleaved with TCEP to reset signal.

Bit Readout Name Sequence (5′→3′) Dye Notes Citation
1 RS0015 ATCCTCCTTCAATACATCCC Cy5 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
2 RS0083 ACACTACCACCATTTCCTAT Alexa750 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
3 RS0095 ACTCCACTACTACTCACTCT Alexa750 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
4 RS0109 ACCCTCTAACTTCCATCACA Cy5 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
5 RS0175 ACCACAACCCATTCCTTTCA Cy5 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
6 RS0237 TTTCTACCACTAATCAACCC Alexa750 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
7 RS0247 ACCCTTTACAAACACACCCT Cy5 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
8 RS0255 TCCTATTCTCAACCTAACCT Alexa750 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
9 RS0307 TATCCTTCAATCCCTCCACA Alexa750 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
10 RS0332 ACATTACACCTCATTCTCCC Cy5 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
11 RS0343 TTTACTCCCTACACCTCCAA Cy5 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
12 RS0384 TTCTCCCTCTATCAACTCTA Alexa750 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
13 RS0406 ACCCTTACTACTACATCATC Cy5 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
14 RS0451 TCCTAACAACCAACTACTCC Alexa750 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
15 RS0468 TCTATCATTACCCTCCTCCT Alexa750 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
16 RS0548 TATTCACCTTACAAACCCTC Cy5 Readout probe (5′ disulfide dye) PNAS 2016 (10.1073/pnas.1612826113)
Encoding vs read-out probes?
Encoding probes hybridize to RNA and carry multiple docking tags (barcode). Read-outs transiently bind those tags and carry the fluorescent reporters.
Do you offer branched/cleavable read-outs?
Yes—2–4 arm designs with cleavable linkers. Delivered with HPLC/UPLC; LC-MS optional.
What is a bDNA amplifier probe and how does it work in MERFISH?
A bDNA amplifier (branched DNA) is a multi-oligo system that increases signal brightness without changing the barcode. Typical flow:
  1. Pre-amplifier binds a designated site on the encoding or readout scaffold.
  2. Amplifier oligos bind repetitively to the pre-amp, creating a branched structure with many fluor docking positions.
  3. Fluors are added directly or via cleavable readouts, preserving cyclic imaging and error-robust decoding.
Result: 2×–10× higher signal (assay-dependent) with minimal change to spot diameter. We supply orthogonal bDNA sets and can kit them per round/channel to match your codebook.
How many cycles will I need?
Depends on barcode length and colors. A 16-bit panel in 2-color mode typically needs ~8 cycles; 4-color can reduce this.
Recommended length and Tm?
18–25 nt, with Tm ≈ 5–8 °C above imaging temperature (buffer-dependent). Mixes with LNA or 2′-OMe can raise Tm for shorter, faster-washing probes.
Ordering checklist
Sequences & length, desired Tm, cleavage mode (SS/PC/enzyme), dyes/channels, purification & scale, buffer constraints (tissue/cell type).

Speak to a Scientist

Full Name *
Email *
Company / Institution *
Phone *
Application
Preferred cleavage mode
Notes(barcode scheme, dyes, rounds, Tm targets)

By submitting, you agree to be contacted regarding your request.

Key References

  1. Chen KH, Boettiger AN, Moffitt JR, Wang S, Zhuang X. Spatially resolved, highly multiplexed RNA profiling in single cells. Science (2015). doi:10.1126/science.aaa6090
  2. Moffitt JR, Hao J, Wang G, et al. High-performance multiplexed FISH in culture and tissue with matrix imprinting & clearing. PNAS (2016). doi:10.1073/pnas.1617699113
    Readout probes purchased from Biosynthesis; disulfide-linked readouts for cyclic imaging.
  3. Moffitt JR, et al. High-throughput single-cell gene-expression profiling with MERFISH. PNAS (2016). doi:10.1073/pnas.1612826113
    Canonical RS0015–RS0548 sequences.
  4. Xia C, et al. Multiplexed detection of RNA using MERFISH and branched DNA amplification. Sci Rep (2019).
  5. Wang G, et al. Multiplexed imaging of high-density libraries of RNAs with MERFISH. Nat Commun (2018).
  6. Wang G, et al. Multiplexed imaging … with MERFISH and expansion microscopy. Sci Rep 8:4847 (2018). doi:10.1038/s41598-018-22297-7
  7. Moffitt JR. MERFISH – Imaging (protocol v1). protocols.io / Zhuang Lab (2018). PDF
    “Prepare readout probes — designed and ordered from Bio-synthesis, Inc. …”
  8. Zhuang Lab. MERFISH: Data & Protocols.
  9. Wang C, et al. Imaging-based pooled CRISPR screening reveals regulators of lncRNA localization. PNAS (2019). doi:10.1073/pnas.1903808116
    “All dye-labeled readout probes based on disulfide linkage were obtained from Bio-Synthesis.”
  10. Zhang M, et al. Molecularly defined and spatially resolved cell atlas of the whole mouse brain. Nature (2023). doi:10.1038/s41586-023-06808-9
    “These readout probes were synthesized and purified by Bio-synthesis.”
  11. Bhattacherjee A, et al. Spatial transcriptomics reveals organization of inhibitory and excitatory neurons. Nat Neurosci (2023). doi:10.1038/s41593-023-01455-9
    Readouts synthesized by Biosynthesis (Cy5/Alexa750 via disulfide).
  12. Luce JJ, et al. Protocol optimization improves MERFISH readout probes in tissue. Sci Rep (2025). doi:10.1038/s41598-025-17477-1
  13. Chaves-Perez A, et al. Metabolic adaptations direct cell fate during tissue regeneration. Nature (2025). doi:10.1038/s41586-025-09097-6
    “Fluorescent conjugated probes were purchased from Bio-Synthesis” via disulfide.
  14. Bio-Synthesis, Inc. MERFISH Read-Out Probes — product page & technical notes (Lewisville, TX).

We can crosswalk your design to literature-style readout sequences on request and provide a citation-ready sequence manifest.

Why Choose Bio-Synthesis

Trusted by biotech leaders worldwide for over 45+ years of delivering high quality, fast and scalable synthetic biology solutions.